EST details — SGN-E210337

Search information 
Request: 210337Match: SGN-E210337
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6363Clone name: cLEC-35-D19
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173909 is on microarray TOM1: SGN-S1-1-6.2.17.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173909 [TUS-17-F19] Trace: SGN-T189139 EST: SGN-E376525 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210337Length: 512 bp (864 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210337 [] (trimmed) TCTTCTTCTTCCATCAAGTCAAAGATTATGGCTCATCCTCACTACCATCGTCTCTTGACTGTTTATTTTTATTTTTCAAAAGATAGGAGCTCCGC
CAGAAGTGGTGGCAAGGCTAGAGGAAATATGTGCCACGTCAGCAACAATGGGCCGTAGCAGTAGTAGTAGTGGTGGTGGAATCATTGGAGAAGAT
CCTGCACTAGATCAGTTCATGGAGGCTTATTGTGAGATGCTGACAAAATATGAACAAGAACTCTCAAAACCCTTCAAGGAAGCCATGGTTTTTCT
TTCAAGAATTGAGTGTCAGTTCAAAGCTTTAACTCTTGCACCTAATTCTTCTCATGAATCTGGTGTAGCTTTGGGCGAGGCAATGGATAGAAATG
GATCATCTGATGAAGAGGTTGACGTGAATAACAGTTTCATCGACCCCCAGGCTGAGGATAGAGAGCTCAAAGGTCAATTGTTGCGTAAGTACAGC
GGTTACTTGGGAAGCCTTAAGCAGGAGTTCATGAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210337] SGN-U578026 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30685 [Download][View] Facility Assigned ID: TCAFI22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0172 Quality Trim Threshold: 14.5