Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C21625

Search information 
Request: 21625Match: SGN-C21625
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C21625Clone name: cLED-34-K16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C176231 is on microarray TOM1: SGN-S1-1-4.3.11.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176231 [TUS-23-G13] Trace: SGN-T181059 EST: SGN-E369485 Direction: 3' Facility: INRA
Clone: SGN-C176231 [TUS-23-G13] Trace: SGN-T181060 EST: SGN-E369486 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243451Length: 336 bp (819 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E243451 [] (trimmed) CAGAATCATTTCATATTTGATGATCAACTTTGAAAGGACAGCTGAAAAATTTATCCTATATTTAGTGTTCATGTTTCTGACATTCAGCTATTTCA
CCTTTTACGGTATGATGGCTGTTGGTCTTACGCCAACTCCACATTTGGCTGCTGTCATTTCATCTGCATTTTATTCGCTGTGGAACCTCATGTCT
GGCTTTCTTGTTCCAAAACCTAGTATCCCTGGATGGTGGATATGGTTCTACTACATCAGCCCAGTGGCTTGGACGTTGCGTGGCATTATTAGCTC
TCAACTTGGCGATGTTGAAGAAATAATAACAGGAACTGGATTTCAAGGNAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243451] SGN-U599423 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57225 [Download][View] Facility Assigned ID: TOVFD68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5