EST details — SGN-C21968

Search information 
Request: 21968Match: SGN-C21968
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C21968Clone name: cLED-35-M8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185058 is on microarray TOM1: SGN-S1-1-1.3.12.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185058 [TUS-46-G8] Trace: SGN-T198995 EST: SGN-E397669 Direction: 3' Facility: INRA
Clone: SGN-C185058 [TUS-46-G8] Trace: SGN-T199746 EST: SGN-E398420 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243752Length: 363 bp (1243 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E243752 [] (trimmed) GGATGTTGAGTACGAGGGAAATGGTGGATGAATGTAAAACGTTCTTCTTCGGTGGACATGAGACCACAGCGCTAGCACTGGCCTGGACTTTGTTG
TTGTTGGCACAGCATCCAGAGTGGCAAAATCAACTCAGAGAGGAAATCAAACAAGTGATGGGTGATGATGGTGAAATAGATGTCACTAAGCTTGT
TGGTCTTAGGAAGATGGGATGGGTGATGAATGAAGTACTAAGACTATACTCACCAGCACCAAATGTGCAAAGGCAAGCTAGAGAAGACATTAAAG
TGGATGATTTGGTCATACCTAATGGAACAAATATGTGGATTGATGTGGTGTCCATGCCTCATGATAAGACACTTTGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243752] SGN-U582892 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57526 [Download][View] Facility Assigned ID: TOVFH76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0109 Quality Trim Threshold: 14.5