EST details — SGN-C22559

Search information 
Request: 22559Match: SGN-C22559
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C22559Clone name: cLED-38-J6
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184177 is on microarray TOM1: SGN-S1-1-2.2.16.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184177 [TUS-44-B15] Trace: SGN-T198243 EST: SGN-E396917 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E244618Length: 283 bp (831 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E244618 [] (trimmed) AAATAATGGTTGTGAGGAAAATCATGGAGAAGATGATTTGTCTGATGATGGATCACAAGCTGGGGAGAAGAAAAGAAGACTGAATATGGAACAAG
TAAAAACTCTTGAGAAAAATTTTGAGTTAGGTAACAAACTTGAACCTGAAAGGAAAATGCAATTAGCAAGAGCTTTAGGGTTACAACCAAGACAA
ATTGCAATTTGGTTTCAAAATAGAAGAGCAAGATGGAAGACTAAGCAATTGGAGAAAGATTATGAACTTCTTAAGAGACAATTTGATGCTATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E244618] SGN-U569795 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58230 [Download][View] Facility Assigned ID: TOVFV51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.892 Expected Error Rate: 0.0121 Quality Trim Threshold: 14.5