EST details — SGN-E227016

Search information 
Request: 227016Match: SGN-E227016
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17607Clone name: cLED-1-H2
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C183974 is on microarray TOM1: SGN-S1-1-5.2.19.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17607 [cLED-1-H2] Trace: SGN-T48527 EST: SGN-E227015 Direction: 5' Facility: TIGR
Clone: SGN-C183974 [TUS-43-J4] Trace: SGN-T199924 EST: SGN-E398598 Direction: 5' Facility: INRA
Clone: SGN-C183974 [TUS-43-J4] Trace: SGN-T199949 EST: SGN-E398623 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E227016Length: 478 bp (827 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E227016 [] (trimmed) CAGAAATAATATAAGATCAAGTAAATGTTTCTATTCAATTTGGTAGTTGAAATAATGTTTGACAGGAATCTGAGGAGGAAAACTTATAACAGTGA
AACAATTGAGCATATAGAACAGTAAGTAATCACTAAATGGAGTAACAAAGAAATATCAATGTGTAACAGAAGAAGACCCTATTTCAGTCATTGGT
GGTGTGAGGTTTGGTGTAGAAGCTTCCGTGGATGGTCGAGTCCCCGTATTCACTCTCCTAACACCCTCTACCATCTTTACTACTTCTGTCATTTT
TGGTCTCTGCTCTGGCATTCTGGATACACAAGTCAAACCTATTTGTAACATCTCCACCATTTCTTCTTCTATATTTGGATACCTCAAAAGCTCCA
CGTCGAATACTTCAGCAGTCCACTCCTCACGAACGACAGAATGTACCCACCTGACTAAGTGGACAATGTCGCTAGTACCTGTGGCATGTGTAGGG
GAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E227016] SGN-U582034 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48528 [Download][View] Facility Assigned ID: TOVAD37TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5