EST details — SGN-E227021

Search information 
Request: 227021Match: SGN-E227021
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17616Clone name: cLED-1-H8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C183976 is on microarray TOM1: SGN-S1-1-3.2.19.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17616 [cLED-1-H8] Trace: SGN-T48532 EST: SGN-E227020 Direction: 5' Facility: TIGR
Clone: SGN-C183976 [TUS-43-J6] Trace: SGN-T197964 EST: SGN-E396638 Direction: 5' Facility: INRA
Clone: SGN-C183976 [TUS-43-J6] Trace: SGN-T198114 EST: SGN-E396788 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E227021Length: 508 bp (832 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E227021 [] (trimmed) TTAATTTATTAAGTACAAATAATACATATCAAACCAATATGTAAAAAGAATTGTAGACTAAAATTCATAAACTGAAAATTCTAGTTCTTGCCTCT
GATCAGACATCAGACAACAAAGAAACCATGTATTTCCTCGTGAGGAAATGTTCCATTTCCAACTCATAAAGTATGTGCTAAATGTTACAATTGAA
ATACATCTTTCTATGCTTTTCTTACACTATTCAAGCAAGTACTATACAAGTAAAAATGCACTAGTACACATATCCAATGCTTAAACAACATGGAT
CTGAATGAAATGTTAATTGCGCGTGGGTGCAATATTTTGGTTTACTACCTTCCAGACATGAGGTTTATCATGCCTTGATTTCCATAGAAAGATCC
AACATCCCAATCTTCTGTTGACGAAGAGAGGGTCATCAACGCAACCACTATTGATCTCATACTTGGTCTTATTAGGGGATTTTCATGGGTGCAAG
CTTTGGCAAGTTGTGCCATCTTCCGGACTGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E227021] SGN-U567777 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48533 [Download][View] Facility Assigned ID: TOVAD40TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0009 Quality Trim Threshold: 14.5