EST details — SGN-E227071

Search information 
Request: 227071Match: SGN-E227071
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17541Clone name: cLED-1-A13
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17541 [cLED-1-A13] Trace: SGN-T48584 EST: SGN-E227072 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E227071Length: 240 bp (775 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E227071 [] (trimmed) CAGGGAACATCAAAGAAGCTTTCACTATCTCGCAATGTATTAGAGCCCGAAGTGCAAGGGGAAAGGATCTAAATCATATGCTTCAATGAAGTGTG
TCTGGCTGTCAAGGGATTGGAATGAAAGTCACTATTAGACAACTTGGCCCATCCATGATCCAGCAAATGCAGCACCCTTGCAACGAGTGTAAGGG
TGCTGGTGAGATGATCAATGATAAAGATAGGTGTGGGCAACTGAACGGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E227071] SGN-U578090 Tomato 200607 Build 2 217 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48583 [Download][View] Facility Assigned ID: TOVAA07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0252 Quality Trim Threshold: 14.5