EST details — SGN-E231011

Search information 
Request: 231011Match: SGN-E231011
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23480Clone name: cLED-5-I12
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185151 is on microarray TOM1: SGN-S1-1-4.3.12.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185151 [TUS-46-K5] Trace: SGN-T198942 EST: SGN-E397616 Direction: 3' Facility: INRA
Clone: SGN-C185151 [TUS-46-K5] Trace: SGN-T198943 EST: SGN-E397617 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231011Length: 341 bp (430 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231011 [] (trimmed) CTTTGATGGTAATCCAAAAAACCAACTTTATGGAAATCTTGGTCCCAAGGATATTTGTACTGAAGATCACCAAGAGCTAGCTCGTGAAGCTGCAA
GACAAGGAATCGTCTTGCTTAAAAACACGGCAGGTTCATTGCCTCTATCCCCCAAATCCATCAAGTCATTAGCAGTCATTGGCCCTAATGCCAAT
CTTGCCTATACCATGGTTGGAAGTTATGAAGGTAAATTGGATACTATGTTCTATTCACTGACGGTATAAAGATTTTTTAACACATGCAGTGTTTA
TATAACTTCAAAACACCAGTTACTAAGAGTCTTTTCTCGCATTTTCTTGAATATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231011] SGN-U580888 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49627 [Download][View] Facility Assigned ID: TOVAR54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0000 Quality Trim Threshold: 14.5