EST details — SGN-E231184

Search information 
Request: 231184Match: SGN-E231184
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23443Clone name: cLED-5-G22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174702 is on microarray TOM1: SGN-S1-1-5.3.15.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174702 [TUS-19-G20] Trace: SGN-T189382 EST: SGN-E376768 Direction: 3' Facility: INRA
Clone: SGN-C174702 [TUS-19-G20] Trace: SGN-T189383 EST: SGN-E376769 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231184Length: 349 bp (442 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231184 [] (trimmed) GTCAGGCACATCACAGCGACAGTTGCATGAGGCACTAGAAGTCACATCTGCTCCTGTTATTTATGAACAGCAGCCACATGTGGTGGAAGAGGATT
TTCTGGAGATGGATGACCTTCTTGGCCCAAAGCCAAACACTCAGAACTTTGATAACTTGGGGCCGTGTGTTCAAAACTTTGATGAGGCATGCCAA
AGTGGTCAAAACTTTGATATGCCTGCTGGAAACTTCGAAGATTTGCCATTCGATTATTTTGATGGGTTGGCAGAGTTTGACCTGTACCATGATGC
ATCCTTGCTTGATGATGTAAGTAACAACTGAAATGGGGCACAAATACTGGAACGCACACGATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231184] SGN-U585288 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49800 [Download][View] Facility Assigned ID: TOVAR47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0199 Quality Trim Threshold: 14.5