EST details — SGN-C23119

Search information 
Request: 23119Match: SGN-C23119
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23119Clone name: cLED-4-I3
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174492 is on microarray TOM1: SGN-S1-1-7.3.16.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174492 [TUS-18-O2] Trace: SGN-T189219 EST: SGN-E376605 Direction: 3' Facility: INRA
Clone: SGN-C174492 [TUS-18-O2] Trace: SGN-T189220 EST: SGN-E376606 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231628Length: 354 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231628 [] (trimmed) CAGAAAGAGAGTGAGTTGATGGGAGCATTTGGAATGTATGAAATGGAAGGATACATTACTCCTAAGAGCTTGAAGATGATGTTGAGTCGACTCGG
CGAGTCAACCTCCATTGATAAATGCAAGGTTATGATAAGGAGATTTGATACTAATGGAGATGGAGTTCTTAGCTTTGATGAGTTCAAAGTTATGA
TGACAAGTTAGAAGAGATATTTGTGTACATAATTCTTTTGGCCTATTGGCCTTGTTATTGTTATTTTATTTCTTCTTGTTTCTAGTAATTATATA
AATGGTTTTTGGTTGAGATTTATACATTCATAGATTCAAATTTGTGAAACAATTCCTTGGTTTTTACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231628] SGN-U570541 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49397 [Download][View] Facility Assigned ID: TOVAM50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.899 Expected Error Rate: 0.0101 Quality Trim Threshold: 12.5