EST details — SGN-C23129

Search information 
Request: 23129Match: SGN-C23129
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23129Clone name: cLED-4-J13
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174501 is on microarray TOM1: SGN-S1-1-6.3.16.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174501 [TUS-18-O11] Trace: SGN-T197205 EST: SGN-E395879 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231711Length: 430 bp (1219 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231711 [] (trimmed) AGCTACAATCCATGTTGAGAATGTAGATGAATTCAAGTGGCTTAATTCTTCATATTGTCCTGTCCTGCGGCAGCTAGAATCTGCTGCTATGAAAG
AATACTATTTCAAGGCTGCTCATCCCAACACCCTATCTGTTGGTTCTTCTAACTTGAAGTACCGGAACCCCAAATATCTTTCAATGCTCAATCAC
CTAAGGTTTTATCTCCCTCAGGTTTATCCAAAATTGAATAAAATCCTTTTTCTTGATGATGACATTGTTGTTCAGAAAGACTTAACAGGATTGTG
GTCAGTTGACCTTCATGGGAAAGTGAATGGTGCAGTTGAAACCTGTGGTCAGAGTTTTCATCGTTTCGACAAGTACCTAAACTTCTCAAATCCTC
ATATTGCTAGAAACTTTGATCCAAATGCCTGTGGGTGGGCATATGGCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231711] SGN-U565385 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49480 [Download][View] Facility Assigned ID: TOVAO55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0147 Quality Trim Threshold: 14.5