Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E231483

Search information 
Request: 231483Match: SGN-E231483
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23124Clone name: cLED-4-I8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174496 is on microarray TOM1: SGN-S1-1-3.3.16.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174496 [TUS-18-O6] Trace: SGN-T189221 EST: SGN-E376607 Direction: 3' Facility: INRA
Clone: SGN-C174496 [TUS-18-O6] Trace: SGN-T189222 EST: SGN-E376608 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231483Length: 455 bp (1377 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231483 [] (trimmed) GCAACAAAACATGTGCAGAGATCAGATGATGATCCGACTGTATTTGATATCACATACCGAGGCTCCCATAATTGTCATCATGCTACTTATTCTGC
ACCACAACCAACATCGCCAGAGAAACAAGAATTCGAAAACCAAGCCGTTTATCCAACAGGGCAGCAATATTCAAATCAAGTGTTGATGAATTTGA
GAGCAAACCTGAGAGTCAATACTAATGACTTGGACGAGAATGACCCAGCAGCATGTCATTTCTCCTTTGTTCCAACATTTTCTTCTGGTATGACA
GACGATAATCGACATTTCCAGATTTCTCATGTCGATGACAACCTGATAGGTAGCGGCTATTCACCGTCTTTTGTCTCTCCTACTACCCCTGAATC
AAACTACTTTTCAGTCTCAACCAGCAGCCAGATGAATGGTTACCGAATGGTTCATAACTTGCACCATTCGGAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231483] SGN-U576111 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49252 [Download][View] Facility Assigned ID: TOVAN52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0115 Quality Trim Threshold: 12.5