EST details — SGN-E231656

Search information 
Request: 231656Match: SGN-E231656
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C22922Clone name: cLED-4-A12
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174341 is on microarray TOM1: SGN-S1-1-6.4.15.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174341 [TUS-18-H19] Trace: SGN-T197251 EST: SGN-E395925 Direction: 3' Facility: INRA
Clone: SGN-C174341 [TUS-18-H19] Trace: SGN-T197252 EST: SGN-E395926 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231656Length: 428 bp (1046 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231656 [] (trimmed) CAGACCCTCTCAGGCAAACTACAACTATGGGCAGCAACATGGTCCAGATTATGGCCATTCATACCCTCATCAGACACAGCATGGACAAGGCTATG
GACATGGATACACTGATGTAAAATATGACCACCAGATGGCACCGCAAAATCAGTATGGAGGACATGGACCTTCTCAGCCAACATCTTACCCTCAA
AGTGGTGCACATCCCAGCTATGGAACCCATGAGCAATACGGTAAACCTCCTTCCTATGGTATGCATCCACAGGCTTCGCAATCTTATAGCCATCC
AAGGGCTAATCAACCTGGAGAAGTGCCATATCAGGGTCCAGCTCCATCAACCCAAGGGTATGGTGCTAGTATGCCGCATCAACAGCAATACCCCT
ATGCAGCCAGTGGGCAAGTGCAACAAACTTACCCTGCATATGGATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231656] SGN-U569992 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49425 [Download][View] Facility Assigned ID: TOVAN06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5