| SGN ID: SGN-C24242 | Clone name: cLED-7-J8 |  | Order Clone |
|
| Library Name: cLED | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis
Microarray: Alias clone
SGN-C184237 is on microarray TOM1: SGN-S1-1-6.1.16.2
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E231932 | Length: 470 bp (836 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E231932 [] (trimmed)
GAAAGACAACCATTTATTTTTTTATTTCATAGATAGCATCAACAAAACTAGCAAGGCAGTAATGAGCTATCCAGCTGATACATTTCATTTTAACA
TAACATAAACATAACCAAACCACACACAATTAAACTAATTAAACATAAAATTTGGCACCATAGCCACCAACTCATGAAGGCTTTAACAATCCTCA
AGCTTGATCTCCACACTTTCAATGGATACACCTTCACCACCAACTTTTGGAACCAAAGTTACCGCAATTGTATCTTCATCTTCCAATCCAATATC
CTCCAACAGTTCAGTTATCGCCAGCGTAAAAGTAACATCCTTAACATGATTATCATTATTTCCATGAACATGAGGCAAGCTAGTATAACTCCCCG
CAAACTCCGCCTTATCAAGTTCTTCTGCATTCACAGTCTTGTCCACGTTCAAAAACACATCGAACCTTACATACTTCGTATGATCATATG
[BLAST] [AA Translate]
| SGN-ID: SGN-T50441 [Download][View] |
Facility Assigned ID: TOVBB52TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.934 |
Expected Error Rate: 0.0024 |
Quality Trim Threshold: 14.5 |
