EST details — SGN-E231932

Search information 
Request: 231932Match: SGN-E231932
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24242Clone name: cLED-7-J8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184237 is on microarray TOM1: SGN-S1-1-6.1.16.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184237 [TUS-44-E3] Trace: SGN-T191875 EST: SGN-E390549 Direction: 3' Facility: INRA
Clone: SGN-C184237 [TUS-44-E3] Trace: SGN-T197592 EST: SGN-E396266 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231932Length: 470 bp (836 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231932 [] (trimmed) GAAAGACAACCATTTATTTTTTTATTTCATAGATAGCATCAACAAAACTAGCAAGGCAGTAATGAGCTATCCAGCTGATACATTTCATTTTAACA
TAACATAAACATAACCAAACCACACACAATTAAACTAATTAAACATAAAATTTGGCACCATAGCCACCAACTCATGAAGGCTTTAACAATCCTCA
AGCTTGATCTCCACACTTTCAATGGATACACCTTCACCACCAACTTTTGGAACCAAAGTTACCGCAATTGTATCTTCATCTTCCAATCCAATATC
CTCCAACAGTTCAGTTATCGCCAGCGTAAAAGTAACATCCTTAACATGATTATCATTATTTCCATGAACATGAGGCAAGCTAGTATAACTCCCCG
CAAACTCCGCCTTATCAAGTTCTTCTGCATTCACAGTCTTGTCCACGTTCAAAAACACATCGAACCTTACATACTTCGTATGATCATATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231932] SGN-U577900 Tomato 200607 Build 2 148 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50441 [Download][View] Facility Assigned ID: TOVBB52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5