EST details — SGN-E232781

Search information 
Request: 232781Match: SGN-E232781
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24398Clone name: cLED-8-B16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181118 is on microarray TOM1: SGN-S1-1-5.3.15.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181118 [TUS-36-C4] Trace: SGN-T193539 EST: SGN-E392213 Direction: 5' Facility: INRA
Clone: SGN-C181118 [TUS-36-C4] Trace: SGN-T199217 EST: SGN-E397891 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232781Length: 518 bp (936 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E232781 [] (trimmed) GCTAGTTGCCCTAAAAGATTAAACCCTAGTTTCTCTCCTTCTGATTTCCACCCAAAAATTCTCCATTATAATCTTAAAGATTTTTGGTTGAGATT
TCCTTAATAGTCTCACCTATATGGGAGAGACTAGAGAAACAATTCAATGAATTTCAGATTTGAAGGAATCGAAGAATCTACCTGCTGTAGCGATT
TGGAGGAACGGGAGAATCCCAGATTTAGTAACTTGGCTCATAAGAGTCATTAATGACAAGTTGACAATGAACTACAAATGATTTGATGAGTTGGC
CAACATTTTAACCACAACTTTCCTCTCTTCTTGAAAAGATCAAATTTCTTAGAAAAGCGTCATTTTAATTAATATACTGAGAGATGCATCAGCTG
AGGTAATAGAAAGTTCCGCTAGTTAAGTGTACTTGGTGCAGAATCACATAAGATGCAACACCTTGCACGTGAGAATGTACAGAAGGTTCTAATGG
AGCAAGAAATGTTATGCTTAGAGCTTGAGAGCATGAAGAAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232781] SGN-U565989 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50714 [Download][View] Facility Assigned ID: TOVBF08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0197 Quality Trim Threshold: 14.5