EST details — SGN-E232943

Search information 
Request: 232943Match: SGN-E232943
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23804Clone name: cLED-6-G17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174968 is on microarray TOM1: SGN-S1-1-3.2.13.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174968 [TUS-20-B22] Trace: SGN-T190101 EST: SGN-E377879 Direction: 3' Facility: INRA
Clone: SGN-C174968 [TUS-20-B22] Trace: SGN-T190102 EST: SGN-E377880 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232943Length: 408 bp (522 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E232943 [] (trimmed) TATTGCCGAGGATATCACCGGGGAAGCTCTGGCCACTCTTGTTGTGAACAAGTTGCGAGGTATACTGAATGTTGCTGCCATCAAAGCTCCTGGAT
TTGGTGAAAGGAGAAAGGCTCTTCTGCAAGATATTGCCATTGTGACAGGAGCTGAGTACCAGGCAACTGATTTGGGCCTGCTCGTTGAGAATACC
CCAGTTGAAGCACTTGGAATTGCCAGAAAGGTGACAATTACCAAGGACTCAACAACCATCATCGCTGATGCAGCATCAAAGGACGAGATACAATC
TAGGATTGCTCAGCTTAAAAAGGAACTGTCTGAGACAGATTCAGTGTACGACTCCGAGAAACTTGCTGAGAGAATTGCCAAGCTTTCTGGGGGTG
TCGCCGTCATTAAGGTTGGAGCTGCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232943] SGN-U579512 Tomato 200607 Build 2 185 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49929 [Download][View] Facility Assigned ID: TOVAU45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5