EST details — SGN-E233132

Search information 
Request: 233132Match: SGN-E233132
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23852Clone name: cLED-6-I17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175011 is on microarray TOM1: SGN-S1-1-8.4.13.6
See unigene SGN-U581008 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C175011 [TUS-20-D17] Trace: SGN-T1339 EST: SGN-E378358 Direction: 5' Facility: Giov. Lab
Clone: SGN-C175011 [TUS-20-D17] Trace: SGN-T190039 EST: SGN-E377540 Direction: 3' Facility: INRA
Clone: SGN-C175011 [TUS-20-D17] Trace: SGN-T190040 EST: SGN-E377541 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233132Length: 416 bp (520 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233132 [] (trimmed) CAGGTAAGCTAAGAGAGAGAAAATGGTGTTGATTGATAAACTTTGGGATGATGTTATGGCTGGTCCCAGCCCTGATAAAGGACTCGGCAAACTCA
GAAAGAGCCTCACTATTCAAACTGGTGGTGAATCAGGAGAAGGATCTAGCAAGTACCAGAGATCTCTGTCGATGCCGGCAAGTCCGCCGACGCCA
GGTACGCCGGTGACGCCGACGAATATATCGCCGACGGTACGGAAAGAGAATGTGTGGAGGAGTGTTTTTCACCCAGGGAGCAATTTAGCTACCAG
GAGAATTGGTGCTGAAGTGTTTGATAAGCCTTCTCACCCTAACGCTCCTACTGTTTATGACTGGCTCTACAGTGGGAACACCAGATCTAAGCATC
ATGAGAAGTGCTGAGAGTTTTTGGGTGGAAAAAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233132] SGN-U581008 Tomato 200607 Build 2 103 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50118 [Download][View] Facility Assigned ID: TOVAU57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5