EST details — SGN-E235015

Search information 
Request: 235015Match: SGN-E235015
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59801Clone name: cLEL-6-H22
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59801 [cLEL-6-H22] Trace: SGN-T17505 EST: SGN-E234727 Direction: 3' Facility: Cereon
Clone: SGN-C59801 [cLEL-6-H22] Trace: SGN-T22286 EST: SGN-E280839 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235015Length: 413 bp (966 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E235015 [] (trimmed) AACACAAAAAGGATTATATTAAAGATTGAATTGGTCTCATAAACCAAAAATGAAAACAAGCATACTGTGCCAAATAACAGCAACTCTTGAAAACT
ATTCAATTCTAGAAGTAACTAGACTTCGGTCTACAAAATGCATAAACAAAAAACTTGCTGTCAGATAAACTGATCCAGCAGTCGGCTCTCGACTT
ACTGGATGTTTGAGGACTTGTTAAGGATAACACCTTCATATTTGACCTGAAACCACTTCATTGAGTCCTCCTTTGTGACCCTGTGTTGGATCCCA
ACCCGAGACTTGCACCTACGACGTCTAGCAACGCGGTATCCTGGGCGTTCCAGGACAACATAGAAATCCATACCATAGATACCAGTTGAAGGATC
ATACTTGATTCCAAGATCAATGTGCTCCTGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235015] SGN-U578115 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T17793 [Download][View] Facility Assigned ID: cC-esflcLEL6H22a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5