EST details — SGN-E235120

Search information 
Request: 235120Match: SGN-E235120
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59857Clone name: cLEL-6-J8
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59857 [cLEL-6-J8] Trace: SGN-T17418 EST: SGN-E234640 Direction: 3' Facility: Cereon
Clone: SGN-C59857 [cLEL-6-J8] Trace: SGN-T22290 EST: SGN-E280843 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235120Length: 418 bp (927 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E235120 [] (trimmed) ACAAAAAGAGAAAATAAACCAGGTTGCTATAGCTTCCCATGGGCAAAACACCCAAATCAACCAAAGATTCAGGGAATTTACCGGTCTATGCCTGC
ACACAAATCCTATATTCCTGTGTTCCTACTTCCTTCCCCTCTTTGGGGTAGCCTTCTTCGGCGGCGACTTCACATTCTTCGCAGGGGCCTCCTTA
ACCGGCTCCTTTTTGGCAGGTGTTGCCTTTGGTGCAGCTTTCCGACTTGGAGTCGTTCTCGTAGCGGTTTTTGCAACCTTAGCTGTCGTCGCCTT
AGCCTTCAGATTTGGCTTGACCGCAGCCTTGGTTTTGGCAGGAGCAGGCTTAGGGTTAACAGCCGCTTTGGGCTTGGCAGCAGCCGCTGCTTTGG
GCTTAGCCTTAGCAACGGGCTTTGCCTTGGCAGCAGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235120] SGN-U579497 Tomato 200607 Build 2 84 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T17898 [Download][View] Facility Assigned ID: cC-esflcLEL6J08d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0275 Quality Trim Threshold: 14.5