EST details — SGN-C23542

Search information 
Request: 23542Match: SGN-C23542
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23542Clone name: cLED-5-K8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174770 is on microarray TOM1: SGN-S1-1-1.2.15.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174770 [TUS-19-J16] Trace: SGN-T189643 EST: SGN-E377289 Direction: 3' Facility: INRA
Clone: SGN-C174770 [TUS-19-J16] Trace: SGN-T189644 EST: SGN-E377290 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231196Length: 262 bp (436 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231196 [] (trimmed) TTGCAGTACCAATGGCCATAACTCAAGGACTTGTCCTAATAGAGGTGTGAAGTTGTTTGGGGTCCGATTGACTGATGGGTTGATTCGAAAAAGTG
CTAGTATGGGTAATTTGTCCCATTTTGCCAGTGGAAGTGGAGGTGGTAGTACACCTCTAAACGGTGTCGTTCATGACTCACCTGGTGATACACCT
GATCATCCTGCTGCTGCTGGTGGCTCTGTTGATGGTTATGCTTCAGAGGATTTTGTTGCTGGTTCTTCATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231196] SGN-U582548 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49812 [Download][View] Facility Assigned ID: TOVAR64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5