Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E235427

Search information 
Request: 235427Match: SGN-E235427
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15139Clone name: cLED-11-A3
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175374 is on microarray TOM1: SGN-S1-1-5.3.13.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175374 [TUS-21-C20] Trace: SGN-T190449 EST: SGN-E377399 Direction: 3' Facility: INRA
Clone: SGN-C175374 [TUS-21-C20] Trace: SGN-T190450 EST: SGN-E377400 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235427Length: 329 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E235427 [] (trimmed) CAGATGATTCGATAGAAGCAAGAGCTATATATGGTGGTCAGAGATTTGCTAGTCAGAATCTGGAACCGTTTTATCAAGGTCACAAAAATACTAGC
ATTTTGCATCCGGTGTTTAAAGGACAAGGTTTGGTTTTATTGGGAGATAGAGAGAAATCAAATTATAGTTATGAGAAGAATTTAGGGGTTTATGA
GATTGAAGTGAAGCTCAATATGCGTATTAGGCTAAAGATTGGCTGGATTAAAACTCATAACACTCAACCTAAAATTGAATGTGATTATAAGGTAC
CTTTGGAGTCTAATGCGTGATCTGGTAATTCTGAAGAAACTAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235427] SGN-U574800 Tomato 200607 Build 2 94 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51437 [Download][View] Facility Assigned ID: TOVBO02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0499 Quality Trim Threshold: 12.5