EST details — SGN-C23654

Search information 
Request: 23654Match: SGN-C23654
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23654Clone name: cLED-5-P8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174835 is on microarray TOM1: SGN-S1-1-8.1.15.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174835 [TUS-19-M9] Trace: SGN-T197447 EST: SGN-E396121 Direction: 3' Facility: INRA
Clone: SGN-C174835 [TUS-19-M9] Trace: SGN-T199888 EST: SGN-E398562 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231117Length: 268 bp (486 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231117 [] (trimmed) CAGATTCACTCAAATTTGTGTATGTTTTTTTAATTAAGAAAAAAAAAAATGTTGGCAATATTCAAAAATGGTGTTGTTGATCCACCAAAGGAGTT
ACAAAGTCCAGCTTCATTACAAGCATCAATTAAAGCTGCAAATCCTGAAGAAACTATGAAGAATTTTTTATCTGCAAATCAAAATAATGGATTTT
CTATTGGATTTATGAATAAGGCTTTTTTGGCATATTCTAATCCTTCAACTTCATACAATACTTTGCCAAGGTTGTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231117] SGN-U567495 Tomato 200607 Build 2 50 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49733 [Download][View] Facility Assigned ID: TOVAT88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.891 Expected Error Rate: 0.0004 Quality Trim Threshold: 14.5