EST details — SGN-E236662

Search information 
Request: 236662Match: SGN-E236662
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15758Clone name: cLED-13-N24
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175690 is on microarray TOM1: SGN-S1-1-1.4.13.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175690 [TUS-21-P24] Trace: SGN-T190763 EST: SGN-E378149 Direction: 3' Facility: INRA
Clone: SGN-C175690 [TUS-21-P24] Trace: SGN-T190764 EST: SGN-E378150 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236662Length: 391 bp (858 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E236662 [] (trimmed) CAGGTGCGCGAGACCTTTGCTTGGATGCACTACTACTGGTATCTTACCAATGATGGCATTGAGTTCCTCAGGACTTACCTCAATCTTCCTTCTGA
AATTGTCCCTGCCACATTGAAGAAGTCTGCTAAGCCCCTTGGTCGTCCCATGGGTGGACCTCCAGGCGATAGGCCCCGTGGACCACCAAGGTTTG
AGGGTGATAGGCCAAGGTTTGGTGATAGGGATGGTTATCGTGCTGGTCCAAGAGGTCCACCTGGTGAATTTGGAGGCGAGAAGGGTGGAGCTCCA
GCTGACTACCAGCCCGCATTCAGGGGTGGTGGTGGAAGACCTGGATTTGGTCGTGGAGCCGGAGGTTTTGGTGGTGCACCCCCTAGTTCAAGCTC
CTAGGTTTCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236662] SGN-U578330 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51940 [Download][View] Facility Assigned ID: TOVBZ84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0196 Quality Trim Threshold: 14.5