EST details — SGN-E237463

Search information 
Request: 237463Match: SGN-E237463
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17425Clone name: cLED-19-K13
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175936 is on microarray TOM1: SGN-S1-1-3.3.11.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175936 [TUS-22-K6] Trace: SGN-T180643 EST: SGN-E368164 Direction: 3' Facility: INRA
Clone: SGN-C175936 [TUS-22-K6] Trace: SGN-T180644 EST: SGN-E368165 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237463Length: 317 bp (971 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E237463 [] (trimmed) AAAATTTGTGCTTATACACTACTCTAATAGAGCTTGCTCCAAGAAGGGGTCTTTCCAAATTCCACTTTTGATTCTTGTTTTAGCAAAATTCTTGT
AAAAAGATTGAATCTTTGTTACCCCTTTTGCCTAAAATCTCTTGTAGCCATGTCTGTCTTCTCTCTTTCTGCTTCCCCTGCTTCAGGTTTTAGTC
TAAACCCTACTAAAACCTCTTCTTATCTCTCTTTTTCCTCTTCCATTAATACCATTTTTGCTCCTTTAACTTCCAACACAACAAAAAGCTTTTCT
GGTTTGACCTATAAAGCAGCTTTGCCTAGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237463] SGN-U575378 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53377 [Download][View] Facility Assigned ID: TOVCU67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.909 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5