EST details — SGN-E237479

Search information 
Request: 237479Match: SGN-E237479
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17222Clone name: cLED-19-A20
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C182512 is on microarray TOM1: SGN-S1-1-3.1.8.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182512 [TUS-39-M6] Trace: SGN-T194893 EST: SGN-E393567 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237479Length: 445 bp (727 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237479 [] (trimmed) CAGGTTCATTGTTCTTGTCAACTTTTGCAAAAATAAACATTTCATATATACAAATATACATGTGTAATATTGTTCACTACAAGGTGGCGAATTCG
AATGATAACAGGAGTAGTAGACAAGACGATGAAGGGATTAATGTGTTTAATACGATGTTTCAAGGGAATATTAATAGAGAAGAAGAAATGTCTGT
TATGGTTTCTGCATTAACTCGTGTTGTTGTTGGTAATCATCCTAGTGAAAATATCGAAAATCATCATCAAAATAATACATTGATTTCTAGGGGTG
TTGGAGAAAAAAGAGGACGTGATGAAGTATTATTACATGGAACTAATTCTTCTCATATGATATTATCATCAGGTGGTGAAGGTTCAAGCATTAGG
ACAACAAGAGAAGCAACATTCATATACACTAATTCAACAAACAATAGCATTATTGATGAATCTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237479] SGN-U586439 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53393 [Download][View] Facility Assigned ID: TOVCV10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5