EST details — SGN-E237592

Search information 
Request: 237592Match: SGN-E237592
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17520Clone name: cLED-19-P12
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175966 is on microarray TOM1: SGN-S1-1-5.4.11.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175966 [TUS-22-L12] Trace: SGN-T180854 EST: SGN-E368672 Direction: 3' Facility: INRA
Clone: SGN-C175966 [TUS-22-L12] Trace: SGN-T180855 EST: SGN-E368673 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237592Length: 398 bp (858 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E237592 [] (trimmed) CTTTGTTCCTTGAAAACGATAGGGAAATGGAAGTTGCTCATTCAGTGGCAGCCACTGCTGGTGATACTGAGGCTACCGACGATGTGAACACTCAT
TTCATCTGCTTCTCCTGTGTTGATGGACAACTCTATGAACTTGATGGGAGGAGGGCAGGACCTATTACACATGGTGCATCCTCTCCAAACAGCTT
ATTAAAGGATGCAGCCACAGTTATCAAAAAGATAATCGAGCAAAATCCAGACTCAATCAACTTTAACGTCATTGCTATTTCGAAAAACGTTTAGA
CCAATGCTGCTGTCTAAGAGGCTTTTATGGATGAGATGTTTAAACCAATTTTAGCTTTTCATGTTTCTGCCTTTTCCAGTACAATGTTTCGTCTT
GTTTGTAAGGCACATATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237592] SGN-U570457 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53506 [Download][View] Facility Assigned ID: TOVCX90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0191 Quality Trim Threshold: 12.5