EST details — SGN-C23773

Search information 
Request: 23773Match: SGN-C23773
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23773Clone name: cLED-6-F1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181311 is on microarray TOM1: SGN-S1-1-4.3.15.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181311 [TUS-36-K5] Trace: SGN-T187658 EST: SGN-E375100 Direction: 3' Facility: INRA
Clone: SGN-C181311 [TUS-36-K5] Trace: SGN-T187659 EST: SGN-E375101 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232988Length: 493 bp (1356 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E232988 [] (trimmed) ATGAATGAAAAATGTTGTCACATAAATTTTAATAATCATAAACAAATTAGTAAACAACTGCTATTGGTTAAGTATTTGACTCTTACCAAAACTAA
GAAATTGAATAATCTAACTAAAAGATTCCTTCTATAACTAAACAACTAGTTGTTTTAATTTTTACCCAATACAAATTAATACAAATGATAACATT
GATCTGAGCTATCAACATCTGAGTTGCTACCATCTTCATGACTTTCTTTCTTCACCACTTTCATTTCTTGAACTGTACTTGTATTGCTCTTTGGA
GTTTCCTCTTTTATCTTGGTATGATGTTCCTCTCTTTTTTTTCTCCAATCACTCTTCCTTTTCCATTGGCTCACTAACAAAATCCCCAAACTTAA
AAACACAGACATTCCCCTATGATCACAACCTCACTTAGCACCCAATGATCCCCCCTTTCCTTGGGGCAATATTGACCATATTGCAGCTATATAAG
CTGATGTCATAAATAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232988] SGN-U564709 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49974 [Download][View] Facility Assigned ID: TOVAW25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.902 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5