EST details — SGN-C23957

Search information 
Request: 23957Match: SGN-C23957
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23957Clone name: cLED-6-M5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175106 is on microarray TOM1: SGN-S1-1-1.4.13.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175106 [TUS-20-H16] Trace: SGN-T190198 EST: SGN-E377976 Direction: 3' Facility: INRA
Clone: SGN-C175106 [TUS-20-H16] Trace: SGN-T190199 EST: SGN-E377977 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233235Length: 547 bp (780 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233235 [] (trimmed) TGAAGATGCATATACAGATCTCATTGCCTCTTCCAGAAAAACCTTGGATTCCATACTGGAATTGCAAGAGGTACTACTGGAGAAGAATCCATCAA
TTACTAAATCAATGGATGTCAATTCTGGTAAAAGGTCGAAGCTTTTGGAAGATTCTGTAAAGTCAGGTGAAGTTGATGATGATTGGCAGAAGATT
TCTCAAATGCATTCAAGGATGGCTGCTTTTAGGGATAAATCGATAGATAAATGGCAGAGAAAGACCCAGGTGACCTCTGGTGCTGCCGCGATCAA
AGGCAAATTGCAAGCATTTAATCAGGATATTAGTCAACAAGTAGCTGGTTATATGAGAGATCCTAGCAAAATGATAAAGGGAATGCAGCAAAGTA
GATCGGCAGTTGCACTATTTGGAACTGTTCCAGATGCTACTGGCAATGGAGAGGGAACAAACATGGATGGTGATCCGGAGCTTCTGGATGACTCT
GAATTCTATCAGCAATTGCTGAGGGAGTTCTTTGAGGCTGTAGATCCCGCATCATCTGAGACAGCATTCTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233235] SGN-U565795 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50221 [Download][View] Facility Assigned ID: TOVAU75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5