EST details — SGN-C23994

Search information 
Request: 23994Match: SGN-C23994
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23994Clone name: cLED-6-O19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175137 is on microarray TOM1: SGN-S1-1-2.1.13.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175137 [TUS-20-I23] Trace: SGN-T189716 EST: SGN-E376961 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233140Length: 396 bp (515 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E233140 [] (trimmed) GTTCTGAGAAATCTTTTGCTAAGCATTCCCATTCGCAAAGTTATCTTCACTAATGCTGATAAGGTCCATGCTCTGAAAGCTCTGAGTAAACTTGG
ATTGGAAGATTGTTTCGAAGGGATATTATGCTTTGAGACACTGAATCCAGTCCACAAGAGCACTCCATCAGATGACGAAGATGACATTGAGTTTG
TTGGATCAGCCACATCCTCCAACGCCACCGCCACTAATGGCTCTGGGATCTTTGACATTATTGGACACTTCTCTCAACCTAAGGCTGGAGCAGAG
TTGCCAAAGACACCAATTGTCTGCAAACCTTCAGAAGTTGCCATTGAACGGGCTTTAAAGATTGCCAACATTAACCCACACAGAACACTTTTCTT
TGAAGATAGTGTCCGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233140] SGN-U581598 Tomato 200607 Build 2 126 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50126 [Download][View] Facility Assigned ID: TOVAU94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5