EST details — SGN-E240379

Search information 
Request: 240379Match: SGN-E240379
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18954Clone name: cLED-25-B5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181246 is on microarray TOM1: SGN-S1-1-5.4.15.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181246 [TUS-36-H12] Trace: SGN-T194098 EST: SGN-E392772 Direction: 5' Facility: INRA
Clone: SGN-C181246 [TUS-36-H12] Trace: SGN-T194197 EST: SGN-E392871 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240379Length: 308 bp (782 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E240379 [] (trimmed) CATCATTGTGGGGGTCAGTGTGTAGTTCCGATAATTTGTTTGTTAGGTATATAATTGCAGGATGTTCCTTGGTATACCTGCTTCCCATCCTTCTA
GTATTCTCGCCCATTCAAATCATGATATTATTGACTTTCTTTTCGATCAAAATGATTTCATAACCACACACAAAAAAAAGCCTCTTCCCTTTGAA
CATGATGCTTGATATTGACATGAGGGTTCTATTTCCCGGTATTGAATAGTTTAGGCAATTAAATTCTGCAAGAATGGATGTTTTCTATGTGGTGA
TAAAGTGGTAGGGGAAGCTGCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240379] SGN-U585204 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T55170 [Download][View] Facility Assigned ID: TOVDU03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0192 Quality Trim Threshold: 14.5