EST details — SGN-E240876

Search information 
Request: 240876Match: SGN-E240876
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18596Clone name: cLED-24-A1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184250 is on microarray TOM1: SGN-S1-1-1.1.16.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184250 [TUS-44-E16] Trace: SGN-T1821 EST: SGN-E378732 Direction: 5' Facility: Giov. Lab
Clone: SGN-C184250 [TUS-44-E16] Trace: SGN-T198151 EST: SGN-E396825 Direction: 3' Facility: INRA
Clone: SGN-C184250 [TUS-44-E16] Trace: SGN-T199955 EST: SGN-E398629 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240876Length: 297 bp (760 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E240876 [] (trimmed) TTAGCCAAGGCAAGTTGCCATTTGGTTCCAAAATAGGAGGGCAAGATGGAAAACAAAGCAATTGGAGAAGCATTATGATGTTCTCAAGAGGGAGT
TTGATGTTATCAAGTCACAAAATGAGGCTCTCCTAGCTCATAACAACAAGCTTCAAGCAGAGATAATGACACTGAAAAATGGAAAGGGGCCAACA
GAATCAATCAATTTGAACAAGGAGACAGATCAAGGTTCAATTTGTAGTACTAGAAGTGAAAATAGCACTGAAATTATGAAGCTGCAATGCAATAA
TATGAAATTAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240876] SGN-U574960 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54773 [Download][View] Facility Assigned ID: TOVDO01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0204 Quality Trim Threshold: 14.5