EST details — SGN-E240965

Search information 
Request: 240965Match: SGN-E240965
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18653Clone name: cLED-24-D11
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175999 is on microarray TOM1: SGN-S1-1-4.1.11.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175999 [TUS-22-M21] Trace: SGN-T180470 EST: SGN-E367856 Direction: 3' Facility: INRA
Clone: SGN-C175999 [TUS-22-M21] Trace: SGN-T180471 EST: SGN-E367857 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240965Length: 394 bp (610 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E240965 [] (trimmed) GCAACATCCTTCCATGTGTTGACCCAAGAACTACAAACCAGACACTATTCAAGAGCAAACAAGTCACTGTTGATCTCGTAAATATTGTTAACGGA
TTTATAGACACATATGCAAATTCCAATCCATCTAATCATGTCAATTCAAATTACTATAACCAGTCAGGACCTGTTATGCCACGTCTCTGCTATCC
ATATGACTCACAATTGCAAGATCTGCCCTGCCTGGCTGATCAAGTGTCTATGGCAAATTCTTCAATGGTTTGGCAGAATTATACTTGCAGTATAT
CTGAGGCCGGAACGTGTACTAGCATCGGTAGGCTGACGCCCGACATGTACGAACAGCTAGTGGCAACGGTCAACATAAGCTACGCTCTCGAACAT
TATGCACCACCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240965] SGN-U563297 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54862 [Download][View] Facility Assigned ID: TOVDQ18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5