EST details — SGN-E241004

Search information 
Request: 241004Match: SGN-E241004
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18702Clone name: cLED-24-F2
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C176016 is on microarray TOM1: SGN-S1-1-3.2.11.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176016 [TUS-22-N14] Trace: SGN-T180866 EST: SGN-E368684 Direction: 3' Facility: INRA
Clone: SGN-C176016 [TUS-22-N14] Trace: SGN-T180867 EST: SGN-E368685 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241004Length: 484 bp (830 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E241004 [] (trimmed) CAGGTAGAGTTACAAAAGTCTTCAGGGGATTCAACAGTATATAGACAGATGTGTAATAGGTTATCGAATGATTTGGGAGTCCACCGTAATGAGGA
GCTCCTACCTACTGTTTGTTGTGATAGCTAGACCATTTGCAGCGGTGACTGGATACATTCTTTCGTTCTTTTTGTTCCTATTCTCCTGCTCTTGT
TGAGTAGTAGCAGGAGTTGTGAGCAGTAAGCACACCCTTCAAGTTGGTTGGTTGATTCATCAGTTTCGCGAGATTAAAGTGTACAGTAAGGAACA
ACATGGCGGAAATCGCCTTATAAGTTAGTACATTCAAGTAAATCTGTATCTTATAGTGTCTATTATTTAGTCTCTAGGCAAATATTTTCTTTGGA
ACATGGCTATAGTAGCCTAGTTGATTTGTAAATTTAGCAAAATTTGTATTCTGTAGTATCAATTATTTGTAGCTTGGTCTTTACTTTGAAAGACT
CCAAGCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241004] SGN-U575600 Tomato 200607 Build 2 39 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54901 [Download][View] Facility Assigned ID: TOVDR25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0177 Quality Trim Threshold: 12.5