EST details — SGN-E241583

Search information 
Request: 241583Match: SGN-E241583
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C22064Clone name: cLED-36-E9
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184448 is on microarray TOM1: SGN-S1-1-3.1.16.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184448 [TUS-44-M22] Trace: SGN-T198220 EST: SGN-E396894 Direction: 3' Facility: INRA
Clone: SGN-C184448 [TUS-44-M22] Trace: SGN-T198221 EST: SGN-E396895 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241583Length: 509 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E241583 [] (trimmed) AATCCTTTCTAGCAGAAAACACTGCAAAATTCTCTCCCAATTCAAGAAAATATGTGTAGAGACAAAAGGGTCTCCATCTTCATTGCCTACATAAC
CCTTCTCAGCTTTGTTTCAAAGGGTATCCATGCATTTGAACCAGAATTCGGGTCGACCCGTGTTGTGTTTCAGACAAATTATGGAGATATCGAAT
TTGGTTTCTACCCTAGTGTTGCGCCAAAGACAGTTGAGCATATCTTCAAGCTAGTGCGCTTGGGAGGCTACAATACCAATCACTTCTTTCGGGTA
GATAAGGGTTTTGTTGCTCAAGTGGCTGATGTTGCTGGGGGGAGGAGTGCACCTATGAATGAAGAACAGAGGGCAGTAGCTGAAAAAAATGTTGT
TGGTGAATTTAGTAAAGTGAAACACGTTAGAGGAATCCTTTCAATGGGAAGGCATGATGATCCTGACAGCGGTTCCTCATCATTTTCAATGCTCC
TTGGAGATGCACCTCATCTTGATGGCACGTATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241583] SGN-U571960 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57753 [Download][View] Facility Assigned ID: TOVFK29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5