Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E241593

Search information 
Request: 241593Match: SGN-E241593
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C22104Clone name: cLED-36-I3
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169837 [TUS-6-M3] Trace: SGN-T350657 EST: SGN-E549782 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241593Length: 296 bp (916 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E241593 [] (trimmed) CTAAAATGTACTTGTGGAATACCTTTACGACCCATTCCCTATTGGACATACTGAAGCATAGAGTCTGACTCTGATCTTTCACTCCAAGCATGTCC
AGGTTTAAGGTCTAATTTACGCCTTGGGCTCCTGCAAGGAGATGACAGTTTCAAAGGCACCAGCCAGGGCTTTCACTCTGGTCTTTCTTTGCTCT
CTAAGCTTACTTGCAGTCTCTTCAATCACATTATTGGAGACCACGGATTCCTTCTTCCCTTGCACCACTTGACGTTGAGGTCTTGATGAAGCTAC
AATAGTATTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241593] SGN-U599004 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57763 [Download][View] Facility Assigned ID: TOVFK50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0274 Quality Trim Threshold: 14.5