EST details — SGN-E242703

Search information 
Request: 242703Match: SGN-E242703
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C25703Clone name: cLEF-14-H16
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C183618 is on microarray TOM1: SGN-S1-1-1.3.2.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183618 [TUS-42-K8] Trace: SGN-T196039 EST: SGN-E394713 Direction: 5' Facility: INRA
Clone: SGN-C183618 [TUS-42-K8] Trace: SGN-T196039 EST: SGN-E399291 Direction: 5' Facility: INRA
Clone: SGN-C183618 [TUS-42-K8] Trace: SGN-T196143 EST: SGN-E394817 Direction: 3' Facility: INRA
Clone: SGN-C183618 [TUS-42-K8] Trace: SGN-T200314 EST: SGN-E399290 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E242703Length: 278 bp (864 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E242703 [] (trimmed) AAACACATCAGCTACTCTTCGTCTTGCCGCCTTCACTGATTTCAGAAGAAAAGTTGAATCTTTACTGTGACATAATTTCCAAATGGCGAATGTAT
GTCCAATTCCAACCAATTCATACAAGCTGGGCTTTATAGGAGCTGGTAAAATGGCTGAAAGTATAGCTAGAGGTGTGGTTAAGTCTGGGATATTG
CCTGCTTCTAGTATTCTAACAGCCCATTCTGGATCAGCTCGTCCAACTGATTTTGAGCCTCTTGGGGTAACTGGTCCAAATAATAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E242703] SGN-U567857 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T59736 [Download][View] Facility Assigned ID: TMGCD44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0214 Quality Trim Threshold: 14.5