EST details — SGN-E244000

Search information 
Request: 244000Match: SGN-E244000
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C25106Clone name: cLEE-1-M19
cartOrder Clone
Library Name: cLEEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seeds and maturing carpels
Development Stage: 5 days post-anthesis to fruit over-ripe stage

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C25106 [cLEE-1-M19] Trace: SGN-T58450 EST: SGN-E244001 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E244000Length: 520 bp (791 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E244000 [] (trimmed) CCACGATGGATATAATAGCATTGGTGGATATTCTGGTGATGGACGTGGTGAATATAACAATGGATATAAGCTTAGAGATGGTGGAAATAAACCTC
CACACGAGGGATACAACACTCCAGGTGGAGAATACAATTCTCCACATGACAAATATAAGTCTCCACGTGACGAATATAAATTTCCTAGTAACGAG
TATAAATCTCCAAGTGACAAATATAACCCTCCACGTGACAAATATAAACTTCCTAGTGATGAATACAAATATCCAGGTGACAAATATAACACCCC
ACATGATAAATATAAATTCCGTAGTGACAAAGACAAACCTCCTAATGACAAATATAAACCCCCTAGTAACGAATACAAGCCTCGTGATAAATATA
AATCCCCTAGTGATGAGTACAAACTTCCAAGTGACAAATATTACCCCCCACATGACAAGTACAAATCCTTTAGTGACAAATACAAACCTCCAGGT
GACAAATATAACCTTCCACGTGACAAATATAAGCCTCCTAGTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E244000] SGN-U581501 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58449 [Download][View] Facility Assigned ID: TSEAA82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0004 Quality Trim Threshold: 14.5