EST details — SGN-E246169

Search information 
Request: 246169Match: SGN-E246169
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26498Clone name: cLEF-40-J7
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176337 is on microarray TOM1: SGN-S1-1-2.3.10.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176337 [TUS-23-K23] Trace: SGN-T181084 EST: SGN-E369510 Direction: 3' Facility: INRA
Clone: SGN-C176337 [TUS-23-K23] Trace: SGN-T181085 EST: SGN-E369511 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246169Length: 499 bp (876 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246169 [] (trimmed) CAATACTGTCAGCACCTCCACAAATGCTACTCCTGGTGTATTTAGTTTTGGTGGTAACTCTTTGGCTTCCCCAACAAATACTGTCAGCACCTCTA
CCAGTGCTACCACTGGCATATTTAATTTTGGTGCTAGTTCTTCCGTTCTGTCAACAAATACTGTCAGTACCTCCACTAGTGCTGCCCCCGGCGTA
TTCAGTTTTGGTGCTAGCTCCTCAGTTCCGTCAACAAATACTGTCAGTACCTCCACTAGTGCTGCCCCCGGCGTATTCAGTTTTGGTGCTAGCTC
CTCAGTTCTGTCAACAAATGCTGTCAATGCCTCCAGCACAGTCAGTCCTAGTCCATTTGCTTTTGGTGCCAGCTCTACCTCCTCACAAACTTCCA
GTGCTGCTGGAATTTTAGGTTCCAATTGGCAGGCCCCTAAGTCTCCTGGCTTTAGTTCCCCATTTAGTTCTGCTACCCCTACTGCATTTGCATTT
GGAGCATCTTCATCTTCTTTTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246169] SGN-U565301 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60021 [Download][View] Facility Assigned ID: TMGGC52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0089 Quality Trim Threshold: 14.5