Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E246232

Search information 
Request: 246232Match: SGN-E246232
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26446Clone name: cLEF-40-G7
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176322 is on microarray TOM1: SGN-S1-1-1.3.11.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176322 [TUS-23-K8] Trace: SGN-T181232 EST: SGN-E369194 Direction: 3' Facility: INRA
Clone: SGN-C176322 [TUS-23-K8] Trace: SGN-T181233 EST: SGN-E369195 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246232Length: 530 bp (794 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246232 [] (trimmed) ATCATGGTGGAATCCCCCATATGATGTTGGGAAAATGAATTCAAATTGGGCAAAAAGTTCATCAAAACATAGGGCTACATCATTGGGCTTTTACT
TATACATGAACGTTTCCCAAAAACAAATTGCAGAGTTACCCTTAGCGTACAGGAATTTTTTTCTGGTTCGACTTAAATTTAAAGACATTTGAATC
CAATCTGGGGCAGAAAGATCACCTGAAATAATTTTGCATCCAAACTTTACAGACTCTTTTTTTTTTTTCAGCCTTGAAAATGCTCCCTGCCACGG
GTGAAAAACGTTTGCCCCACATAACCCCCATGCATTGCCCTTTTGACATTGGATTCAAACATCTTCGGGTTGGCTCTCAATACAACAGCTGCATC
GTGATTGGGGGGATCCTCATGATTCGGCTCCCTGAACAGATGATTTAAGCCCTAGATAATGGGGTTAATGTTGAGCACAGGCTTCCAGTCTTTTT
GAAAAATGTTGAGACACACATTTCCTTCCAAGTCGATATTTGGGTGGTAAACCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246232] SGN-U578204 Tomato 200607 Build 2 154 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60084 [Download][View] Facility Assigned ID: TMGGA40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0228 Quality Trim Threshold: 14.5