EST details — SGN-E246757
| Search information |
| Request: 246757 | Match: SGN-E246757 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C27682 | Clone name: cLEF-45-D12 |
| ||
| Library Name: cLEF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: mature green
Microarray: Alias clone SGN-C176712 is on microarray TOM1: SGN-S1-1-3.3.9.16
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C176712 [TUS-24-K14] | Trace: SGN-T193340 | EST: SGN-E392014 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E246757 | Length: 190 bp (884 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E246757 [] (trimmed)
CACGAGTCTTGATGACTCTGCAGCTGCTAATGAGAATAGCAAGAATCGTTGATTGCATGAAACAGTTACAGAAGTCGAAGAAGTGAAAATGGTGC
TCAAATTGATTCCCATATGGTCCACATGCATACTTTTTTGGACAGTATACTCTCAGATGAATACCTTCACCAGCTTACTATCTCACTGCATGGAC
TCAAATTGATTCCCATATGGTCCACATGCATACTTTTTTGGACAGTATACTCTCAGATGAATACCTTCACCAGCTTACTATCTCACTGCATGGAC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E246757] | SGN-U589135 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T61492 [Download][View] | Facility Assigned ID: TMGGX18TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.963 | Expected Error Rate: 0.0316 | Quality Trim Threshold: 14.5 |
Working
