EST details — SGN-E246800

Search information 
Request: 246800Match: SGN-E246800
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26695Clone name: cLEF-41-E3
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176415 is on microarray TOM1: SGN-S1-1-4.3.11.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176415 [TUS-23-O5] Trace: SGN-T181096 EST: SGN-E369522 Direction: 3' Facility: INRA
Clone: SGN-C176415 [TUS-23-O5] Trace: SGN-T181097 EST: SGN-E369523 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246800Length: 478 bp (936 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246800 [] (trimmed) GCGAGGAGACAGCAGCGCCGCTACTCTTTCTCCTCCACGACGAGCTCCGGCGAAATGCGTCCGACGCCGTCCTCTTTCTCCTCTCTCGCCTGACC
TTTTCCCTTTACCCTCGCTCTTCCACCTTATCCTCTCTCCTCTCTTCTCCAGGCCAGGTGAGGAGAATAACAGAATCTCCATCGACAGTAAGCAA
CAATAATCGGAGAGAACTAGCAAGGCAGTGCAGCCAGCAGCTCCGGCGATGCAGTGAAACCAGGCGAGACTCACCGGCGTAAGTGTTAAGCTGGT
CTGCCTATCTCATCTGTTTCCTCTCCTTTTCTAGTGAAATAAGCAGAACTCCGGCCAGCAAATTCTCATTTTCGTTTGAGTTTGGTGTGATTTTT
TTATTTAATTTTTTTGGGCATGTTTTAGTCTATAGAAAATTATGTGATATACTAATCGCTGCATTTATATTTTTATATATTGTACTCTTACTTTT
ATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246800] SGN-U575448 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60215 [Download][View] Facility Assigned ID: TMGGE26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0144 Quality Trim Threshold: 14.5