Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E247276

Search information 
Request: 247276Match: SGN-E247276
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28083Clone name: cLEF-46-I13
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176879 is on microarray TOM1: SGN-S1-1-4.2.8.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176879 [TUS-25-B13] Trace: SGN-T181872 EST: SGN-E368919 Direction: 3' Facility: INRA
Clone: SGN-C176879 [TUS-25-B13] Trace: SGN-T181873 EST: SGN-E368920 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247276Length: 303 bp (424 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247276 [] (trimmed) CCTCTTTCAGGGGAGAGTTAATCCTTTAAGACTTTGCAAGTCGCTTCTTGCCAGCCTTCAAGGGAAAATAAAACCACATTGTGAACTCACCTTTC
ATCCTTTTGTTTGTTTATCACTGTTACTGGTTTATTCTCTATGTTGGAGCAGACTTTGACTCATTTACTTCTTTTTCTTCATCATCAATTGTTAT
GACATCTTCTGATTTATGGGCTGTTTTCTTGTTCTTTCTCTGCACTTGCTGATATAGATTTCGAGAAAGAGATGTCCACCCAGGTTTTTATATTG
TGTGATAAGCCAAAAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247276] SGN-U576767 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61687 [Download][View] Facility Assigned ID: TMGGY55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5