EST details — SGN-E247363

Search information 
Request: 247363Match: SGN-E247363
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28132Clone name: cLEF-46-K3
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176900 is on microarray TOM1: SGN-S1-1-7.3.8.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176900 [TUS-25-C10] Trace: SGN-T181727 EST: SGN-E369235 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247363Length: 333 bp (424 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E247363 [] (trimmed) ATTGCAGTTGCTGCTCTTGGAATGTTGAGCACAATTGCAACGGGATTGGCTATTGATGCATATGGTCCTATCAGTGACAATGCTGGAGGCATTGC
TGAGATGGCTGGCATGAGCCACCGGATCCGTGAAAGAACCGACGCCCTTGATGCAGCTGGAAATACCACTGCTGCGATTGGAAAGGGCTTTGCCA
TTGGATCTGCTGCACTTGTGTCTCTGGCTCTGTTTGGTGCTTTTGTTAGTCGGGCTGCAATTTCAACGGTTGATGTCTTGACCCCCAAGGTGTTT
ATTGGTTTGATTGTTGGAGCCATGCTTCCCTACTGGTTTTCTGCCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247363] SGN-U584600 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61774 [Download][View] Facility Assigned ID: TMGGY62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5