EST details — SGN-E247425

Search information 
Request: 247425Match: SGN-E247425
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28150Clone name: cLEF-46-L20
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176908 is on microarray TOM1: SGN-S1-1-7.3.8.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176908 [TUS-25-C18] Trace: SGN-T181728 EST: SGN-E369236 Direction: 3' Facility: INRA
Clone: SGN-C176908 [TUS-25-C18] Trace: SGN-T181729 EST: SGN-E369237 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247425Length: 552 bp (942 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247425 [] (trimmed) AAAAGTATATCTTATCATACTACTAGAAATTTGGGATCTCAATGTTTTCTCGTTCCAGTATCTCTTGTTGCAATGAACTAGTAGTGGGAGAGATA
ACTTGATTTTAGGCTGAAGGCCTTTCCATTCTTACTGGTGAGTTATATTTTTCCAGATCAGCCGATGATGCTAATGTATTTCTTGTCAACGACTT
TCAAGATCCACTCCAGAGAACTCTCTCCTCCTTGGAACTTCCTAGGGCTGTTTCTGTAACTAACAGTCCATCATCAGCTGCACCTAGCGAATCCC
CATCTAGCTGGACAGAGGGGGAAACTTTTGATAGAAATTCTGCACTTGCTCAACAAAATGCCAGGCAAAGACAAAAACATAATGATCCTGCTCGA
GATTTGTCAATTCAAGTACTAGAGAAATTTTCTCTTGTGACCAGATTTGCTCGTGAAACGACATCACAACTTTTTGGTGAAGCTCAGGGAGATAG
TTTTGTCTCTAATGACAGGAGGAATCACGATGGAAAAACATATGATTATCCTCGCATTGCCGAATCTAATGATGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247425] SGN-U569710 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61836 [Download][View] Facility Assigned ID: TMGHB70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5