Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E248297

Search information 
Request: 248297Match: SGN-E248297
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32375Clone name: cLEG-1-C11
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183653 is on microarray TOM1: SGN-S1-1-6.4.1.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183653 [TUS-42-L19] Trace: SGN-T196100 EST: SGN-E394774 Direction: 5' Facility: INRA
Clone: SGN-C183653 [TUS-42-L19] Trace: SGN-T196204 EST: SGN-E394878 Direction: 3' Facility: INRA
Clone: SGN-C183653 [TUS-42-L19] Trace: SGN-T196204 EST: SGN-E399409 Direction: 3' Facility: INRA
Clone: SGN-C183653 [TUS-42-L19] Trace: SGN-T200379 EST: SGN-E399410 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248297Length: 455 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248297 [] (trimmed) TTTGGATGCTCTGTTGGTCAGATCAGTTACAGCAATGGCGGTAGGGGCGCTATTCTCTCCGACATTTATGCCCGCAAAGCGGACATATTATTGCG
AGGTTACTATGGTTGGAACTCAAGACGTGCTATACAGGTCCTTGATCAAGTGTTTCCAAAGGATGCAACTGTTCAGCCTACATTGGTGATTGTTT
ACTTTGGTGGTAATGATTCAATGGGACCTCATTCATCTGGATTGGGTCCTCATGTACCTCTTCCAGAGTACATTGAGAACATGAGAAAAATTGCA
ACTCATCTCAAGAGCATCTCAGAGAATATTCGCATAATTTTTCTCAGTTGTCCACCTGTTGACGAGGCCAGAATTCGTGAAAATACAAGTGCATA
TTTCAGTGAGTTGGTTCGAACAAATGAATTGTGTCGACAGTATTCTGAGGCCTGTATAGAGCTATGCCAAAGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248297] SGN-U571000 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64360 [Download][View] Facility Assigned ID: TBFAA18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0061 Quality Trim Threshold: 20.5