Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E248354

Search information 
Request: 248354Match: SGN-E248354
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32360Clone name: cLEG-1-A5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183411 is on microarray TOM1: SGN-S1-1-8.2.1.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183411 [TUS-42-B17] Trace: SGN-T196066 EST: SGN-E394740 Direction: 5' Facility: INRA
Clone: SGN-C183411 [TUS-42-B17] Trace: SGN-T196066 EST: SGN-E399340 Direction: 5' Facility: INRA
Clone: SGN-C183411 [TUS-42-B17] Trace: SGN-T196188 EST: SGN-E394862 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248354Length: 362 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248354 [] (trimmed) AAAAGATCAAATAGGCGGGATTGTTAATGGGAACACTTTCAATTCAATCAGCTAACCATTTGCTGTCCCACATAATAAGATCATATGATAAAGAA
AAACTGCAGGTACTGCCGTACTGGTTACAGCAAGTACCCAAGGTTTAGAAGAAACACCCGACATAAATAAGCAAAAAAGACCAAATATTAAAAAC
TACATGAAACATAATCTTCAATGCAAAACTTCTAGCAGAAGCACTCCACCAGACATCTAGCACTTGATCTCCTTCAAACCAGGTGCAATGTACAA
AAAGGTAGGATCAGCTGAACCCTCCTTGTAGTACGCAAACACCAGGGCGCCATCATCATGCATGCTCTCACCAACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248354] SGN-U581240 Tomato 200607 Build 2 734 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64417 [Download][View] Facility Assigned ID: TBFAA03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0275 Quality Trim Threshold: 20.5