EST details — SGN-E248356
| Search information |
| Request: 248356 | Match: SGN-E248356 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C32374 | Clone name: cLEG-1-C1 |
| ||
| Library Name: cLEG | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: breaker fruit
Microarray: Alias clone SGN-C183647 is on microarray TOM1: SGN-S1-1-4.4.1.4
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C183647 [TUS-42-L13] | Trace: SGN-T196098 | EST: SGN-E394772 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183647 [TUS-42-L13] | Trace: SGN-T196098 | EST: SGN-E399599 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183647 [TUS-42-L13] | Trace: SGN-T200378 | EST: SGN-E399408 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E248356 | Length: 158 bp (988 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E248356 [] (trimmed)
CTGGAGTTCAATTTTGTTTATTTTTTCAAGGGAATCTTGTTAAAGGAAGTGACTTCTAACACTAGGCTGATGATGAAACATGAGTGACATATATC
AAATATCTTCAACCATATACTAAATTATAATATTATTTTTTAAAAAAAAGTCTATTCAGTTTG
AAATATCTTCAACCATATACTAAATTATAATATTATTTTTTAAAAAAAAGTCTATTCAGTTTG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E248356] | SGN-U593746 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T64419 [Download][View] | Facility Assigned ID: TBFAA13TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.846 | Expected Error Rate: 0.0183 | Quality Trim Threshold: 14.5 |
Working
