EST details — SGN-E248360

Search information 
Request: 248360Match: SGN-E248360
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32396Clone name: cLEG-1-E3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183657 is on microarray TOM1: SGN-S1-1-2.4.1.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183657 [TUS-42-L23] Trace: SGN-T196205 EST: SGN-E394879 Direction: 3' Facility: INRA
Clone: SGN-C183657 [TUS-42-L23] Trace: SGN-T196205 EST: SGN-E399412 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248360Length: 522 bp (854 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248360 [] (trimmed) TTTTTGTGAACTTCGACGATTCGCTCGATGTCTAAACACAGCTCCGACTGTCCCACCTATGAATTTCACCGGCAACTATGGTTCTACGAACGTAA
CAATACCGACGTTACAACCTACGGACCAAATATTAGTCAATCCTGAGAAAAAAGTACTCAATTTTGATGATGTTAAAGAGTTGTTTACGGGTGTA
TCCACCTCGAAGTTGATTAGATCATCGTTAACACTTCAAATGGCATCGATTGAGTCTATGGTTGACCTAGGTATTTGGGTAATGAATTCGAAATT
CATGCGTATGCCAGTATTTAAGGAGGTGATACTAGGGTTTGTTAAAAGGACATTTTATGAACATTTTTGTGCTGGAAAAGACTTAATTGAAGTAG
GAAAGACGGTTAGTAAGTTGTCGAGCCTTGATTTAAAAGGCATGCTTGATTATGGTGTGGAACATGCAATGGATAATGAGTCTTGTGATCGAAGT
ATGAATGTTTTTCTTCAGACAGCCGAATTAACCAAGTCTCTTCCATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248360] SGN-U578070 Tomato 200607 Build 2 64 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64423 [Download][View] Facility Assigned ID: TBFAA26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0251 Quality Trim Threshold: 14.5