EST details — SGN-E248907
| Search information |
| Request: 248907 | Match: SGN-E248907 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C28817 | Clone name: cLEF-49-F11 |
| ||
| Library Name: cLEF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: mature green
Microarray: Alias clone SGN-C176995 is on microarray TOM1: SGN-S1-1-8.3.8.6
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C176995 [TUS-25-G9] | Trace: SGN-T181666 | EST: SGN-E369804 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E248907 | Length: 132 bp (944 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E248907 [] (trimmed)
CTCATGATGATTTTGAAAACAAACATGGAGCTATCACCTCCATGGATGAAAATGCTGATGGATTCAGAGATCTTGTTAGGCACACAATGTTTGAG
AAAGGACAAAGTAAACGAATTTGGAGTGAGCTCTACA
AAAGGACAAAGTAAACGAATTTGGAGTGAGCTCTACA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E248907] | SGN-U562701 | Tomato 200607 | Build 2 | 49 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T62415 [Download][View] | Facility Assigned ID: TMGHM30TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.958 | Expected Error Rate: 0.0495 | Quality Trim Threshold: 14.5 |


