EST details — SGN-E248927

Search information 
Request: 248927Match: SGN-E248927
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28990Clone name: cLEF-49-N11
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177100 is on microarray TOM1: SGN-S1-1-7.3.8.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177100 [TUS-25-K18] Trace: SGN-T1435 EST: SGN-E378758 Direction: 5' Facility: Giov. Lab
Clone: SGN-C177100 [TUS-25-K18] Trace: SGN-T181768 EST: SGN-E369276 Direction: 3' Facility: INRA
Clone: SGN-C177100 [TUS-25-K18] Trace: SGN-T181769 EST: SGN-E369277 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248927Length: 442 bp (926 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248927 [] (trimmed) CAAAACCCAAGAACATTTTTGGCTACTGAAAATTTCCAAAAAGTACTAAAAAAAGACATCTTTTTTCAATTTTACTGCACTTTTTTGCCGCCTCC
ATCACTGAAAAAATGTTGTTCAACTTCCTCTACTATCATCTTCATCACTTTCTCATAGCTGAAAATTGCTTCAGAAAATGAAAAAGGAGACATTT
TTAAATTTCCAAGAAAAGACCATGGATGGTGTCATTAAGAGGAGGTCTTTATATGCAATTGGTTCTTGTTTTCTGCTTTTTCTCTTAGCTTACAA
CAGTTCCACTGTGTTCTATGTTCAAGTCCCTGTTCCAGGGAACTCTTCGCCGGAGATTTCAAGTTTTTTAACTGAAAATGTCGCCAGAAAATCAA
GAAAGTTGGTTTCTTTATCTACTTCAGCTAAACGTTCATCCTCTGCGATATATGCTGTAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248927] SGN-U564723 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62435 [Download][View] Facility Assigned ID: TMGHM78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5